Issue

Vol. 25 No. 11 (2013): Vol 25 Issue 11

Copyright (c) 2013 AJC

Creative Commons License

This work is licensed under a Creative Commons Attribution 4.0 International License.

Spectroscopic Studies on the Interaction of Hemin with Human Telomeric G-Quadruplex DNA

https://doi.org/10.14233/ajchem.2013.14817
Xu-Jian Luo
College of Chemistry and Chemical Engineering, Central South University, Changsha 410083, Hunan Province, P.R. China ; State Key Laboratory Cultivation Base for the Chemistry and Molecular Engineering of Medicinal Resources, School of Chemistry and Chemical Engineering of Guangxi Normal University, Guilin 541004, P.R. China
Qi-Pin Qin
State Key Laboratory Cultivation Base for the Chemistry and Molecular Engineering of Medicinal Resources, School of Chemistry and Chemical Engineering of Guangxi Normal University, Guilin 541004, P.R. China
Ke-Bin Huang
State Key Laboratory Cultivation Base for the Chemistry and Molecular Engineering of Medicinal Resources, School of Chemistry and Chemical Engineering of Guangxi Normal University, Guilin 541004, P.R. China
Yan-Cheng Liu
State Key Laboratory Cultivation Base for the Chemistry and Molecular Engineering of Medicinal Resources, School of Chemistry and Chemical Engineering of Guangxi Normal University, Guilin 541004, P.R. China
Hong Liang
College of Chemistry and Chemical Engineering, Central South University, Changsha 410083, Hunan Province, P.R. China ; State Key Laboratory Cultivation Base for the Chemistry and Molecular Engineering of Medicinal Resources, School of Chemistry and Chemical Engineering of Guangxi Normal University, Guilin 541004, P.R. China

Corresponding Author(s) : Yan-Cheng Liu

ycliugxnu@yahoo.cn

Asian Journal of Chemistry, Vol. 25 No. 11 (2013): Vol 25 Issue 11

Abstract

The interaction behaviours of hemin as a ligand binding with three types of human telomeric G-quadruplex DNA were examined by UV-visible and circular dichroism spectroscopic methods. The circular dichroism spectra of these three types of G-quadruplex DNA all showed major positive absorption peaks at ca. 290 nm with shoulder peaks at ca. 270 nm, along with a negative absorption peak at ca. 250 nm. The presence of hemin did not induce obvious circular dichroism spectral changes of these G-quadruplex DNA, which indicates that hemin is able to stabilize human telomeric antiparallel G-quadruplex DNA structure. For comparison, the addition of hemin induced obvious increment on the characteristic antiparallel circular dichroism absorption of the corresponding single-chain human telomeric sequences, which suggests that hemin may induce and stabilize the formation of antiparallel G-quadruplex DNA even in the absence of K+. On the other hand, the addition of the three types of G-quadruplex DNA into the hemin solution with gradually increasing concentrations induced significant hypochromicity (31.86-47.26 %) along with 11-23 nm of bathochromicity on the UV-visible absorption of hemin. From this result, it is suggested that the high binding affinity of hemin to antiparallel G-quadruplex DNA is based on the intensive intercalative binding mode of hemin to antiparallel G-quadruplex DNA by the p-p stacking between the macrocyclic aromatic hemin and the guanine quartet.

Keywords

G-quadruplex DNA Hemin Telomeric DNA Intercalative binding
Luo, X.-J., Qin, Q.-P., Huang, K.-B., Liu, Y.-C., & Liang, H. (2013). Spectroscopic Studies on the Interaction of Hemin with Human Telomeric G-Quadruplex DNA. Asian Journal of Chemistry, 25(11), 6396–6400. https://doi.org/10.14233/ajchem.2013.14817
Download Citation
Endnote/Zotero/Mendeley (RIS)
BibTeX
References
  1. V.A. Zakian, Science, 270, 1601 (1995).
  2. S. Neidle and G. Parkinson, Nature Rev. Drug Discov., 1, 383 (2002).
  3. L.H. Hurley, Nat. Rev. Cancer., 2, 188 (2002).
  4. J.L. Mergny, J.F. Riou, P. Mailliet, M.P. Teulade-Fichou and E. Gilson, Nucleic Acids Res., 30, 839 (2002).
  5. R.K. Moyzis, J.M. Buckingham, L.S. Cram, M. Dani, L.L. Deaven, M.D. Jones, J. Meyne, R.L. Ratliff and J.R. Wu, Proc. Natl. Acad. Sci. USA, 85, 6622 (1988).
  6. S. Neidle and S. Balasubramanian, Quadruplex Nucleic Acids; The Royal Society of Chemistry: Cambridge (2006).
  7. A.J. Zaug, E.R. Podell and T.R. Cech, Proc. Natl. Acad. Sci. USA, 102, 10864 (2005).
  8. S. Redon, P. Reichenbach and J. Lingner, Nucleic Acids Res., 38, 5797 (2010).
  9. G.R. Suzanne, S.P. Daniel, L. Angela, L. Leroy, J.L. Edmond and E.R. Joseph, J. Med. Chem., 53, 3632 (2010)
  10. S.N. Georgiades, N.H. Abd. Karim, S. Kogularamanan and V. Ramon, Angew. Chem. Int. Ed., 49, 4020 (2010).
  11. R. Kieltyka, P. Englebienne, J. Fakhoury, C. Autexier, N. Moitessier and H.F. Sleiman, J. Am. Chem. Soc., 130, 10040 (2008).
  12. V. Gabelica, E.S. Baker, M.P. Teulade-Fichou, E. De. Pauw and M.T. Bowers, J. Am. Chem. Soc., 129, 895 (2007).
  13. T. Mikuma, T. Ohyama, N. Terui, Y. Yamamoto and H. Hori, Chem. Commun., 1708 (2003).
  14. R. Kieltyka, J. Fakhoury, N. Moitessier and H.F. Sleiman, Chem. Eur. J., 14, 1145 (2008).
  15. The human telomeric sequences used in this work: Htel-1: TAGGGTTAGGGTTAGGGTTAGGG; Htel-2: TAGGGTTAGGGTTAGGGTTAGG GTT; Htel-3:GGGTTAGGGTTAGGGTTAGGGT.
  16. S. Paramasivan, I. Rujan and P.H. Bolton, Methods, 43, 324 (2007).
  17. T. Mashimo, H. Yagi, Y. Sannohe, A. Rajendran and H. Sugiyama, J. Am. Chem. Soc., 132, 14910 (2010).
  18. K.W. Lim, S. Amrane, S. Bouaziz, W. Xu, Y. Mu, D.J. Patel and K.N. Luu, J. Am. Chem. Soc., 131, 4301 (2009).
  19. A. Ambrus, D. Chen, J. Dai, T. Bialis, R.A. Jones and D.Z. Yang, Nucleic Acids Res., 34, 2723 (2006).
  20. A. Arora and S. Maiti, J. Phys. Chem. B, 112, 8151 (2008).
  21. C.V. Kumar and E.H. Asuncion, J. Am. Chem. Soc., 115, 8547 (1993).
Read More
Author biographies is not available.
Download
PDF
Statistic
Read Counter : 1 Download : 0